
she/they | lesbiab | artist | nerdart and sillinessDFTBA
345 posts
I-might-be-a-possum - In The Walls - Tumblr Blog
In the recent past, women were told by society that they could have a fulfilling relationship or a career, but not both. There’s been a push to “have it all!” more recently, of course, but that’s not what this post is about. This post is about how James T. Kirk occupies the unique position of a male character who had to choose one or the other. There are few male characters other than him who are genuinely and unabashedly hopeless romantics who want to settle down but aren’t allowed to by the narrative. And if you view The Search for Spock as a romantic drama, then Kirk also kind of fulfills the typical female character trope of “learning that romantic love is actually more important than a career.”
As you can see, Captain James T. Kirk’s arc mirrors many female romance protagonists, and he is therefore, textually, wife material. In this essay, I will—
really hate when people flippantly talk about killing themselves over like, something tedious or mildly annoying. it’s not funny say something different ❤️


Highly intellectual conversation.
Kirk: It’s a weird mirror.
Spock: It is probably not a mirror.
Kirk: What mirror?
Spock: Well, this weird mirror.
Kirk: It is probably not a mirror.
did you write the intros and outros for the epilogue and the fluff episodes? they're so iconic i feel like being called a greedy little content goblin should deter me from handing over my money but it doesn't
Yes I think I wrote intro and outro for all special content in Archives and Protocol. Certainly if it's in my voice for those, I wrote it.
Charles: Hello friends! The Squad: Charles: You might be wondering why I’m taped to the ceiling.
gang..... i have some sad news..........
the queue is empty 😔😔😔😔😔

Today's advice from your Goth Auntie
Stop slouching, drink some water, take your meds.
Don't say yes to things just because you think you "should".
The Lurking Horror got tangled up in washi tape. Literally tangled. There was wailing.
❤️ Auntie Jilli
Ah yes, the two genders.

Transgender
And
Britain


dyhard crumbs i love you dyhard crumbs

crazy how a dude who's already dead can become even deader
My guilty pleasure right now is watching luxury hotel reviews and I found this british guy who keeps accidentally clipping into the backrooms.
He's unintentionally making the best liminal horror content on youtube
new notthem design just dropped

Why humidity? Just why? Nobody ever wanted wet air!
To make things more interesting
how’s everyone doin tonight i just broke tumblr
Headcanon that the eye feeds Jon information about the social queues his autism is missing but it doesn’t change how Jon acts because every time he just goes “What? That is stupid I don’t believe that’s what a neurotypical person would do” so he ignores it.
Following you is so amazing because I could just be reading an already random or normal post and directly below it is a computer voice saying letters and then a picture of a snail
String identified: gaagcactagaaaaatacttactcagttatactaa
Closest match: Cabera pusaria genome assembly, chromosome: 9 Common name: Common White Wave

(image source)

FORGOT TO POST THIS
I was so nervous to do this but
Eye docs



I'm so wearing these when I go to Manchester for the protocol s2 thing

girlbossed her way into misery


More tma cat designs! Redesign of Cat!Elias, Cat!Peter Lucas and Cat!Simon Fairchild!
Enjoy evil tma cats lol
ok um dead boy detectives spoilers i guess but i truly cannot get over this episode??
the a plot is the trio terrorises a homophobe and bonds over being victims of boys who go too far. the ‘nice guys’ they’re trying to help ruined two women’s lives and then get dragged down to hell. also the trio all takes turns friendzoning each other. and edwin says ‘this is far too much emotion for one day’ perhaps thee most british line ever uttered on television and also maybe stolen from downton abbey. who’s to say
the b plot is my angry mom begrudgingly opens her heart and then has to kill a girl on the first date
the c plot is the continuing adventures of a literal evil magical crow who has been turned into a pouty little twink falling for his mark. this bitch’s evil crow turned out to be a useless fucking homosexual, gave a 70 year old ghost his first kiss and then got REJECTED.
homie sat back down on the swings and i knew in that moment he wished he could’ve stayed a fucking bird
this is the best television has ever been