i-might-be-a-possum - in the walls
i-might-be-a-possum
in the walls

she/they | lesbiab | artist | nerdart and sillinessDFTBA

345 posts

I-might-be-a-possum - In The Walls - Tumblr Blog

i-might-be-a-possum
9 months ago

In the recent past, women were told by society that they could have a fulfilling relationship or a career, but not both. There’s been a push to “have it all!” more recently, of course, but that’s not what this post is about. This post is about how James T. Kirk occupies the unique position of a male character who had to choose one or the other. There are few male characters other than him who are genuinely and unabashedly hopeless romantics who want to settle down but aren’t allowed to by the narrative. And if you view The Search for Spock as a romantic drama, then Kirk also kind of fulfills the typical female character trope of “learning that romantic love is actually more important than a career.”

As you can see, Captain James T. Kirk’s arc mirrors many female romance protagonists, and he is therefore, textually, wife material. In this essay, I will—

i-might-be-a-possum
9 months ago

really hate when people flippantly talk about killing themselves over like, something tedious or mildly annoying. it’s not funny say something different ❤️

i-might-be-a-possum
9 months ago
Highly Intellectual Conversation.
Highly Intellectual Conversation.

Highly intellectual conversation.

Kirk: It’s a weird mirror.

Spock: It is probably not a mirror.

Kirk: What mirror?

Spock: Well, this weird mirror.

Kirk: It is probably not a mirror.

i-might-be-a-possum
9 months ago

did you write the intros and outros for the epilogue and the fluff episodes? they're so iconic i feel like being called a greedy little content goblin should deter me from handing over my money but it doesn't

Yes I think I wrote intro and outro for all special content in Archives and Protocol. Certainly if it's in my voice for those, I wrote it.

i-might-be-a-possum
9 months ago

Charles: Hello friends! The Squad: Charles: You might be wondering why I’m taped to the ceiling.

i-might-be-a-possum
9 months ago

gang..... i have some sad news..........

the queue is empty 😔😔😔😔😔

i-might-be-a-possum
9 months ago
i-might-be-a-possum - in the walls
i-might-be-a-possum
9 months ago

Today's advice from your Goth Auntie

Stop slouching, drink some water, take your meds.

Don't say yes to things just because you think you "should".

The Lurking Horror got tangled up in washi tape. Literally tangled. There was wailing.

❤️ Auntie Jilli

i-might-be-a-possum
9 months ago

Ah yes, the two genders.

Ah Yes, The Two Genders.

Transgender

And

Britain

Ah Yes, The Two Genders.
i-might-be-a-possum
9 months ago
Dyhard Crumbs I Love You Dyhard Crumbs

dyhard crumbs i love you dyhard crumbs

i-might-be-a-possum
9 months ago
Crazy How A Dude Who's Already Dead Can Become Even Deader

crazy how a dude who's already dead can become even deader

i-might-be-a-possum
9 months ago

My guilty pleasure right now is watching luxury hotel reviews and I found this british guy who keeps accidentally clipping into the backrooms.

He's unintentionally making the best liminal horror content on youtube

i-might-be-a-possum
9 months ago
i-might-be-a-possum
9 months ago

new notthem design just dropped

New Notthem Design Just Dropped
i-might-be-a-possum
9 months ago

Why humidity? Just why? Nobody ever wanted wet air!

To make things more interesting

i-might-be-a-possum
9 months ago

how’s everyone doin tonight i just broke tumblr

i-might-be-a-possum
9 months ago

Headcanon that the eye feeds Jon information about the social queues his autism is missing but it doesn’t change how Jon acts because every time he just goes “What? That is stupid I don’t believe that’s what a neurotypical person would do” so he ignores it.

i-might-be-a-possum
9 months ago

Following you is so amazing because I could just be reading an already random or normal post and directly below it is a computer voice saying letters and then a picture of a snail

String identified: gaagcactagaaaaatacttactcagttatactaa

Closest match: Cabera pusaria genome assembly, chromosome: 9 Common name: Common White Wave

Following You Is So Amazing Because I Could Just Be Reading An Already Random Or Normal Post And Directly

(image source)

i-might-be-a-possum
9 months ago
FORGOT TO POST THIS

FORGOT TO POST THIS

i-might-be-a-possum
9 months ago

I was so nervous to do this but

Eye docs

I Was So Nervous To Do This But
I Was So Nervous To Do This But
I Was So Nervous To Do This But

I'm so wearing these when I go to Manchester for the protocol s2 thing


Tags :
i-might-be-a-possum
9 months ago
Girlbossed Her Way Into Misery

girlbossed her way into misery

i-might-be-a-possum
9 months ago
i-might-be-a-possum - in the walls
i-might-be-a-possum
9 months ago
More Tma Cat Designs! Redesign Of Cat!Elias, Cat!Peter Lucas And Cat!Simon Fairchild!

More tma cat designs! Redesign of Cat!Elias, Cat!Peter Lucas and Cat!Simon Fairchild!

Enjoy evil tma cats lol

i-might-be-a-possum
9 months ago

ok um dead boy detectives spoilers i guess but i truly cannot get over this episode??

the a plot is the trio terrorises a homophobe and bonds over being victims of boys who go too far. the ‘nice guys’ they’re trying to help ruined two women’s lives and then get dragged down to hell. also the trio all takes turns friendzoning each other. and edwin says ‘this is far too much emotion for one day’ perhaps thee most british line ever uttered on television and also maybe stolen from downton abbey. who’s to say

the b plot is my angry mom begrudgingly opens her heart and then has to kill a girl on the first date

the c plot is the continuing adventures of a literal evil magical crow who has been turned into a pouty little twink falling for his mark. this bitch’s evil crow turned out to be a useless fucking homosexual, gave a 70 year old ghost his first kiss and then got REJECTED.

homie sat back down on the swings and i knew in that moment he wished he could’ve stayed a fucking bird

this is the best television has ever been