Mean Anon - Tumblr Posts
why tf are you writing this shit. it’s disgusting. i bet you’re a american fetishizer you racist bigot. eat soap and die in a hole you pos
oh my god...????? what did i do to you???? (·•᷄∩•᷅ ) i am not racist or a bigot at all this isnt very cool man
just block me if you dont like my works no need to be so mean
dumb fetishizer bitch. i’m korean and you sexualizing us is fucking insane. i hope you get hand foot and mouth disease weirdo. koreaboos always piss me off can you americans not write normal shit about your own kind? quit sexualizing my race. 🖕🏻

you’re a fucking abomination for writing about gay people. fucking faggot bitch, damn i can’t read any kpop fics without them being gay.
????OH MY GOD????

you write the most awful gay smut i’ve ever seen, don’t quit your day job
IT NEVER ENDSSSS 😭😭
i am a korean gay man and your posts are not at all appropriate, they are racist and disgusting. i truly hope you seek help for this porn addiction. you deserve jail time for the disgusting racist posts and i’m finally speaking up about it, hence the other people speaking out about their discomfort with your account. all of the people defending you should touch grass. i come on here to see updates of my favorite members. some of the members you write about are JUST legal. that is predatory behavior and it is awful.
i aint reading allat

Oh my God stop fucking glazing bella’s writing this shit is ass and it needs to be fucking deleted. Nobody is fapping to this stupid shit lmfao if you like a fetishing fat bitch “as a chubby gal myself…” Jesus Christ it’s always the fat fucking whores 🤣🤣🤣
get a load of this guy 😭
turning off my inbox for the night cause why did an anon just tell me their fantasies of unspeakable acts towards me hello.😭

i hate you so much i’m doxxing your genetic sequence ATGCTCTTAGGTCTAGATCTATGGAACTCATCCATGCTCTTAGGTCTAGATCTATGGAACTCATCCGGATCCATTGGATTCTAATGCTCTTAGGTCTAGATCTATGGAACTCATCCATGCTCTTAGGTCTAGATCTATGGAACTCATCCATGCTCTTAGGTCTAGATCTATGGAACTCATCCGATTTACTCGCTAATCC
what does this mean ?😭
(for Feral J AU RT) You needed a haircut anyways, it was too long!
That's really hurtful, anon! It wasn't JUST hair, it was a lovely gift from my old J. She spent HOURS weaving it and styling it.. it kept me warm and it made me feel safe... I will have to wait a while before it grows back, but I will grow it back out nice and long and I will be more careful next time. But be more kind with the words you say, it's really hurtful to say that to a girl who already had PTSD in regards to unwanted haircuts.